Human Variation & Race

Human Variation & Race

Solar radiation impacts the survival of humans with too high or too low of levels of exposure. Solar radiation is needed for the body to receive Vitamin D. Having inadequate amounts of Vitamin D can contribute to high blood pressure, weakened protection of UV rays, and lack developmental factors such as skeletal deformities. Overexposure of UVB radiation can cause damage to the DNA. UVB radiation is directly absorbed into the cells by the DNA which can cause skin cancer. This damage at the genetic level disturbs homeostasis and is life threatening to the species.

 

Humans have adapted to higher levels of solar radiation in many ways, and there are many factors of the adaptation. Unfortunately, we do not have a short term adaptation. When there is too much exposure to solar radiation, the skin burns.

Melanin is 1 out of 3 factors that alter skin color to assist with protection from the UV exposure by absorbing the UV (ultra-violet) radiation that causes genetic mutations. The melanin production is a result of facultative adaptation – tanning. Tanning is the result of temporarily increased melanin production caused by exposure of solar radiation. For some individuals, their skin tone changes from the summer months to the winter months when there is less exposure. This response occurs in all humans except for Albinos who carry a genetic mutation that prevents their melanocytes from producing melanin.

This leads to the developmental change. Individuals that have had a higher exposure to solar radiation tend to have a darker complexion due to the increased production of melanin. Individuals located in warmer climates such as the tropics tend to wear less clothing due to the heat; therefore, their skin is more exposed to the solar radiation. Over time, these individuals will produce more melanin and they will have a darker skin tone. Individuals whose cells do not adapt to the change become more likely to develop life threatening skin cancers. Individuals that are in northern locations tend to have a colder climate which requires them to wear additional clothing. The additional clothing blocks the UV exposure which does not allow the melanin to produce as rapidly as those in warmer climates. The lack of melanin leaves these individuals with a fair skin tone.

There are many cultural adaptations to high solar radiation. There is the old fashioned way of protecting ourselves – shelter and shade, and then clothing. There are also the advanced methods like sunglasses and umbrellas, and most importantly, sunscreen. Although sunscreen doesn’t keep someone completely protected, it allows individuals with fair skin to be exposed for a longer than normal period of time without causing damage.


The benefit of studying across environmental clines is to see how different people adapt to certain environmental influences. If we studied only one environment, we wouldn’t be able to see the positive and negative impacts of solar radiation. For example, if we were to only study the hotter climates, it would be much harder to discuss the effects of sunburns and skin cancer, or how the melanin protects the skin. The different adaptations can be used to resolve some of the health issues we see today. Being able to see the impact across different cultures provides us with a better understanding as to how much solar radiation is a healthy amount.

 

Using race to understand the variation of the adaptations of solar radiation allows us to look at the specific differences between the races to see how each one’s traits are beneficial to their environment; however, the study of environmental influences is better. Although we can study the different races to see how each one is better suited for their environment, if we study the environment, we can see how these individuals adapted to fit their environment.

Language Blog

Part 1: You were asked to engage in a conversation for 15 minutes where you were not allowed to use any version of a symbolic language (no speaking, writing, or ASL).

Holding a conversation with someone when you are unable to speak makes the conversation very difficult. In an effort to communicate without saying anything, I turned to acting out my responses during the conversation. This was hilarious to my husband, which whom I was speaking to, but very aggravating for me because I could not get my point across unless my husband was patient and paid very close attention. It turned into more of a game then a conversation, and then the game quickly became more of an annoyance. The conversation was no longer a conversation because neither one of us wanted to try and talk about anything that would be too hard to discuss. By the end of the 15 minutes, the only thing accomplished was a good laugh. My husband thought it was funny to watch me struggle through my efforts of communication; however, if this had been a long term project, I believe we would end up learning how to communicate with one another by learning each other’s language.

In a scenario where these were two separate cultures, the culture that can speak would have the advantage in explaining the complex ideas. The speaking culture usually becomes impatient with the other culture because speaking has such a quick response, where other means of communication take time and effort. Individuals in our culture that have difficulty with spoken language are the deaf. My next door neighbors are deaf, and at first, it was very difficult to speak with them, but eventually, we learned how to communicate with one another. They were very patient with me and my husband and we were very patient with them. It’s been 2 years since we’ve been neighbors, and communicating has become much easier, but we still do not get to talk about larger scale things because of the complications in our communication. The most important thing is to be understanding and patient. If patience is shown, and the effort is given, the language barrier can be broken.

Part 2: You were asked to spend 15 minutes communicating without any physical embellishments, i.e., no hand signals, not vocal intonation, not head, facial, or body movements.

Holding a conversation with someone when you are unable to show any type of emotion or movement in correlation with your conversation is also very difficult, but not as difficult as the first experiment talked about above. The conversation was easier than the first because we understood each other’s communication, but following the guidelines was much harder. Immediately, I failed this experiment by raising my eyebrows when I responded to a question. I soon failed again from the tones of my voice, then a hand gesture, and so on. I continued through the 15 minutes with miserable success. It is so deeply embedded in my character to talk with my hands, and to annunciate questions or statements with a clear question or excitement in my tone.

My partner in this experiment wasn’t affected during our conversation; however, had he not been aware of what I was doing, there was a great potential of him feeling unappreciated, under-valued, etc. because I was not able to show any reaction or emotion. To me, I felt very robotic and removed from the conversation.

The use of signs in our language is very important. Body language is a very big key in understanding one another. Slouching, slumping, eye contact, etc. are all very important in the messages. Some people don’t pick up on body language as easily as others, but it is a natural instinct to recognize a person’s body language. The benefit of reading body language is a key to our daily lives. For example, the certain look from a parent to their child when they are interrupting a conversation, the co-worker that is yawning and not keeping eye contact while being informed of a new process. Aside from reading body language, it is important that we also pay attention to our own. I can’t think of a scenario where it would be a good idea to not read body language, but it is so important to be in tune with your own, for example, body language in a job interview to show confidence, not nervousness or showing the enthusiasm during someone’s conversation. Overall, body language is its own unique form of communication that we must use in our daily lives.

The Piltdown Hoax

The Piltdown Hoax

In 1912, in southeast England, in the village of Piltdown, an amateur archeologist, Charles Dawson found an ancient human skull. This discovery was important because it was the first primitive remains found in England and they were possibly the oldest as well. After the discovery, Dawson invited a member of the National History Museum, a leading geologist, Arthur Smith Woodward and French paleontologist, Pierre Teilhard de Chardin to join in the discovery. These 3 men found multiple finds at the site. Dawson soon located a jaw, from the same skull that was found earlier. It was the missing link of apes and humans. The jaw bone was that of an ape and the teeth looked human, proving the evolution theory. This thrilled the science community, and set the new tone of the link between apes and humans. Future studies were even based off of this find.

Later however, fossils were found in Asia and Africa, but these were less human-like but lived after Piltdown Man. These findings questioned the advancement of the Piltdown Man and the evolutionary process. It wasn’t until 1949 that fluorine was introduced to measure the age of fossils. This test was performed and stated that Piltdown man was much younger than originally stated. Then, in 1953, a full analysis was completed proving that Piltdown Man was a modified female orangutan skull that was modified. Scientists were obviously stunned at these findings and realized that not all scientists are going to be honest about their findings.

Human faults are normally positive in science because accidents lead to discoveries, such as penicillin! However, the fault recognized in the Piltdown Man was greed. This type of self-centered act threw off scientists and their research. Had Piltdown Man never been “created” scientists may have been on a different research path that may have lead them down a more successful road; however, this also may have been one of the best things to happen to science as it taught a very valuable lesson on the importance of scientific tests and proving discoveries.

The processes that became available to science were extremely helpful in revealing the skull was fraudulent. The starting point to this realization was the fluorine test. The fluorine test was able to prove that Piltdown Man wasn’t nearly as old as what they had once thought. This opened the doors to many more tests revealing the filing marks on the teeth, cuts were made to the structure and the stains on the bones were falsified.

As previously stated, removing the “human” factor isn’t the way to go. Human mistakes and thoughts are a great asset to discovery. Piltdown Man wasn’t an error, it was a bad judgment in believing in a scientist. Fortunately, we have tests today that assist the science community in testing the validity of things. This allows us to keep the “human” factor that science/discovery depends on.

The life lesson here is that not everyone can be trusted, and those you think can be trusted might not be trustworthy. Some things can be taken at face value, but something important should be questioned or at the very least, verified.

Dentition Patterns

Dentition Patterns:

Lemurs:

Lemurs are arboreal – they live in trees. Lemurs can easily adapt to any environment which allows them to live all over the place, but they are mainly found in rainforests.

Lemurs are herbivores and rely on a variety of food for survival but their main diet is nuts and fruits. The dentition pattern of a lemur is 2-1-3-3 (incisors, canine, premolars, molars). The lemur’s incisors are mainly used for grooming and are commonly broken.

 

Spider Monkey:

Spider monkeys live in rainforest areas, preferably with a canopy of trees. They are usually in moist areas but will live in dryer locations if they must.

The diet of a spider monkey is mainly fruits. If they must, they will eat other items, but they swallow them whole. They will eat sap or tree bark if they must. The dentition pattern of a spider monkey is 2-1-3-3.

Baboon:
Baboons can be found in tropical or dry areas. They are very versatile primates. They spend a great deal of time both in the tress and on the land. A change to their environment doesn’t seem to bother them.

Due to their versatility of land and trees, their diet can differ. Baboons mainly consume plants but they will also eat insects and small animals. The dentition pattern of a baboon is 2-1-2-3.

Gibbon:
Like lemurs, gibbons are arboreal – they live in trees, in tropical regions.

The majority of a gibbon’s diet is fruit; however, they also consume many other different foods found in the trees - such as twigs, leaves, flowers, insects, and eggs. The dentition pattern of a gibbon is 2-1-2-3.

Chimpanzee:

Chimpanzees are very adaptable and dwell in rainforests, woodlands, and grasslands. Chimpanzees spend much of their time in trees for mobility, shelter, and food sources.

Chimps normally consume a diet of fruits and plants, but they also eat other things such as small animals and insects. The dentition pattern of a chimpanzee is 2-1-2-3.

In Summary:

All of these primates are heterodonts. They each have a combination of incisors, canines, premolars, and molars. The lemurs and the spider monkeys share the same pattern of 2-1-3-3 where the baboons, gibbons, and chimpanzees share the pattern of 2-1-2-3.

The canines on these primates are used to tear through their food, although the sizes of the canines differ for each primate. Lemurs and spider monkeys have smaller canines due to their restricted diet. The chimpanzees, baboons, and gibbons consume small animals and insects, so these primates have larger canines. The baboon, gibbon, and chimpanzee’s canine is also used for intimidation.

As all of these primates are tree-dwelling, their dentition pattern is matched for consuming a diet that can be found in the trees.

 

Analogy & Homology

For your homologous traits provide the following information:

a.       Briefly describe the two different species that possess the homologous trait.

-          The two species that represent the homologous trait are the alligator and the bat. Both species possess the same “arm” structure.

 

b.      Describe the homologous trait of each species, focusing on the differences in structure and function of the trait. Why do these homologous traits exhibit differences between the two species? Make sure your explanation is clear and complete.

-          Both species possess the same “arm” structure. The bat’s wing and the alligator’s front legs both have a humorous, radius, ulna, and carpals. Both of these species use their “arms” to eat and maneuver around. The differences in the traits are the following. The bat’s wing structure helps support and manipulate the bat to fly where the alligator’s assist with running and propelling itself through the water.

 

c.       Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologous trait?  

-          The bat and the alligator share a common ancestor that also shared the same anatomical “arm” structure. The common ancestor of the reptile and the mammal is the amniotes.

 

d.      Provide an image of each species in this comparison.

 

For your analogous traits provide the following information:

a.        Briefly describe the two different species that possess the analogous trait.

-          The two different species that possess the analogous trait are the koala bear and the squirrel. Both species inherited the ability to digest poisons.

b.      Describe the analogous trait of each species, focusing on the similarities in structure and function of the trait. Clearly explain why these analogous traits exhibit similarities between the two species.

-          Over time, both the squirrel and the koala bear were able to digest poisons. The koala bear’s main source of food is the eucalyptus leaves. These leaves are poisonous to most animals. Over time, the koala bears became tree dwelling animals, and the eucalyptus leaves became their main source of food. The koala bears developed special bacteria in their stomachs that break down the toxins from the eucalyptus leaves. The squirrels as well developed the ability to eat and digest toxins for tree sourced food. They developed special saliva to help process the food that carries tannin, the toxic chemical. Acorns is a common food that carries tannin.

c.       All pairs of organisms share some common ancestor if you go back far enough in time. Did the common ancestor of these two species possess this analogous trait? Why or why not?

-          The koala bear and the squirrel do not have a common ancestor that possessed this analogous trait. The ability to eat and digest the poisons were the result of a common environmental pressure that caused both species to develop a similar adaptation to that stress, parallel evolution. It indicates a genetic relationship that exists between these species.

d.      Provide an image of each species in this comparison.

 

 

 

Protein Synthesis

TTAGTACACCTAAGACGTAACGGTCTGAAGTGGCTTGATCGTCG

Historical Influences on Darwin

Historical Influences on Darwin

One of the most influential people to Charles Darwin was Thomas Malthus. Malthus’s theory of the Principle of Population positively influenced the completion of Darwin’s theory on natural selection; however, in my opinion, an underlying influence to Charles Darwin was Jean-Baptiste Lamark. Lamark believed in an evolution based on environmental changes. Although Lamark was later found to be incorrect on his theory of how traits were passed through generations, his idea that, environmental needs influence a change in a species, was the starting ground to Charles Darwin’s theory of natural selection.

“Lamarck is credited with helping put evolution on the map and with acknowledging that the environment plays a role in shaping the species that live in it.” Corbis. “Evolution” PBS.com. 2001. August 30, 2012 <http://www.pbs.org/wgbh/evolution/library/02/3/l_023_01.html>

The point most directly affected by Lamark’s work is: If the environment changes, the traits that are helpful or adaptive to that environment will be different. Lamark believed that if a species struggled in certain environmental areas, they would change, and that change would be passed off to their offspring. This thought process is similar to Darwin’s; however, Darwin believed that the positive traits were passed down through offspring and would eventually be the norm. The change was not immediately passed down to the next generation. Darwin was not responsible for proving Lamark’s theory wrong, but his theory of natural selection was another possibility to the influence of environmental changes.

Charles Darwin may not have been able to complete his theory of natural selection without the influence of Lamark because Lamark laid the groundwork to the idea of environmental influences.

The attitude of the church affected Darwin’s desire to publicize his work because the idea of evolution was, and still is, a very controversial topic. Similar to today, the conversation of evolution separates into church and science.